View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1380_low_63 (Length: 227)

Name: NF1380_low_63
Description: NF1380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1380_low_63
NF1380_low_63
[»] chr7 (1 HSPs)
chr7 (1-227)||(48170391-48170618)


Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 48170618 - 48170391
Alignment:
1 ttctctaacttgctggaaagatatgaagaaataagtagcatgagacgtgtatcttaaggattatttcactgtggaggtaattttaatgatgtgaatatcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48170618 ttctctaacttgctggaaagatatgaagaaataagtagcatgagacgtgtatcttaaggattatttcactgtggaggtaattttaatgatgtgaatatcc 48170519  T
101 atctggactcttctgcaatgagctccagttaa-nnnnnnngttaactcgttgctgtttcttcttcatttatgaggctaatttcacgaatcataaatataa 199  Q
    ||||||||||||||||||||||||||||||||        |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
48170518 atctggactcttctgcaatgagctccagttaattttttttgttaactcattgctgtttcttcttcatttatgaggctaatttcacgaatcataaatataa 48170419  T
200 ttatgggcttgatcttcgttttttggta 227  Q
    ||||||||||||||||||||||||||||    
48170418 ttatgggcttgatcttcgttttttggta 48170391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University