View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381-INSERTION-1 (Length: 315)
Name: NF1381-INSERTION-1
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381-INSERTION-1 |
 |  |
|
| [»] scaffold0332 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0332 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 8 - 315
Target Start/End: Original strand, 7055 - 7361
Alignment:
| Q |
8 |
gaaatagtgaagtttacctcagctatagttgggaactcttatcatacctctatcaagaatggcttcaacgacactaactccgatcacctgacgaggattt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7055 |
gaaatagtgaagtttacctcagctatagttgggaactcttatcatacctctatcaagaatggcttcaacgacactaactccgatcacctgacgaggattt |
7154 |
T |
 |
| Q |
108 |
cttttaaggtaagacaatattttatcttggagtagtgttcagatcaacttcgtgtactagaatataattggatttcaaaatgttgtatccaaaattacta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7155 |
cttttaaggtaagacaatattttatcttggagtagtgttcagatcaacttcgtgtactagaatataattggatttcaaaatgttgtatccaaaattacta |
7254 |
T |
 |
| Q |
208 |
tttttcatatcacagccctttgatttaacttttaagacatgnnnnnnncacatcaataaagccctcatttcaagaaatacctttttcttcatgtttgatt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7255 |
tttttcatatcacagccctttgatttaacttttaagacatg-aaaaaacacatcaataaagccctcatttcaagaaatacctttttcttcatgtttgatt |
7353 |
T |
 |
| Q |
308 |
aacctaat |
315 |
Q |
| |
|
|||||||| |
|
|
| T |
7354 |
aacctaat |
7361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University