View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13811_low_5 (Length: 281)
Name: NF13811_low_5
Description: NF13811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13811_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 43407634 - 43407896
Alignment:
| Q |
1 |
taccttatttatttccttttttcatttctctttaatttgcgttcttattattctactacgtacgtgttctcctcaactactttaattaatt----aattc |
96 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
43407634 |
tacctaatttatttccttgtttcatttctctttaatttccgtacttattattctac---gtacgtgttctcctcaactacttaacttaatttaataattg |
43407730 |
T |
|
| Q |
97 |
actctcttcttcattccctttctctaatatatatcttgacatgaatgatatcttctgatctttttatataggaggatctgagaaagaactttaattataa |
196 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43407731 |
actct-tccttcattccctttctctaatatatatcatgacatgaatgatatcttctgatctttttatataggaggatctgagaaacaactttaattataa |
43407829 |
T |
|
| Q |
197 |
ggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggagg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407830 |
ggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggagg |
43407896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University