View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13811_low_7 (Length: 235)
Name: NF13811_low_7
Description: NF13811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13811_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 43407527 - 43407333
Alignment:
| Q |
1 |
ttgcgtcaatgcttttgcttaattgatat---at-tttagatgatcaacaggtctcctatttaatgaccaaaaatgcaatttcaatttctttatattttt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407527 |
ttgcgtcaatgcttttgcttaattgatatgatatatttagatgatcaacaggtctcctatttaatgaccaaaaatgcaatttcaatttctttatattttt |
43407428 |
T |
 |
| Q |
97 |
agtttagttggacccactagtaagctaaagcagcgactggcctatatctatattttatatctctatattctctttcacaattagcagcgctgtaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407427 |
agtttagttggacccactagtaagctaaagcagcgactggcctatatctatattttatatctctatattctctttcacaattagcagcgctgtaa |
43407333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University