View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13812_high_6 (Length: 350)
Name: NF13812_high_6
Description: NF13812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13812_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 94 - 227
Target Start/End: Complemental strand, 30917991 - 30917858
Alignment:
| Q |
94 |
aattaatggtttggaaataaactctatattttaattgattttatttaatttaaatttgtaccttgctttacatcttaagaaaactataacagtgttggct |
193 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30917991 |
aattaaaggtttggaaataaactctatattttaattgattttatttaatttaaatttgtaccttgctttgcatcttaagaaaactataacagtgttggct |
30917892 |
T |
|
| Q |
194 |
tggattatatatgtgaaaaaccattttttcatga |
227 |
Q |
| |
|
|| |||||| |||| |||||||||||||||||| |
|
|
| T |
30917891 |
tgcattatacatgttgaaaaccattttttcatga |
30917858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 35 - 95
Target Start/End: Complemental strand, 30918107 - 30918050
Alignment:
| Q |
35 |
gatatatgttatattcatgaatagagttctgagctaatgttgtgtcaaaaatcactagcaa |
95 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
30918107 |
gatatatgttatattcatggatagagttgtgagctaatgttgtgt---aaatcactagcaa |
30918050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 305 - 338
Target Start/End: Complemental strand, 30917759 - 30917726
Alignment:
| Q |
305 |
tttgtttttcatattttcatatctttatcatttc |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30917759 |
tttgtttttcatattttcatatctttatcatttc |
30917726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University