View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13812_high_9 (Length: 293)
Name: NF13812_high_9
Description: NF13812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13812_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 286
Target Start/End: Complemental strand, 36836552 - 36836283
Alignment:
| Q |
19 |
tggcatgctagtttgacagttgggctgcgtagcgtcagcttgtgacctaagtgggggaaccaaggtgttgagacatggctttggcttaactttaacaggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36836552 |
tggcatgctagtttgacagttgggctgcgtagcgtcagcttgtgacctaagtgggggaaccaaggtgttgagacatggctttggcttaactttaacaggg |
36836453 |
T |
 |
| Q |
119 |
ttgggtacaacgtactgaggctctcatgcattatcacgagccacttcccctcaatcccacaacacctagtgagcctagatcattatcacaagaacagttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36836452 |
ttgggtacaacgtactgaggctctcatgcattatcacgagccacttcccctcaatcccacaacacctagtgagcctagatcattatcacaagaacagttg |
36836353 |
T |
 |
| Q |
219 |
tcaaa--cgcgcgcacacatgttgaaatcctctatagaacggttttaggattgaatattgtattgatttt |
286 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36836352 |
tcaaactcgcgcacacacatgttgaaatcctctatagaacggttttaggattgaatattgtattgatttt |
36836283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 75
Target Start/End: Complemental strand, 43171453 - 43171420
Alignment:
| Q |
42 |
gctgcgtagcgtcagcttgtgacctaagtggggg |
75 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
43171453 |
gctgagtagcgtcagcttgtgacctaagtggggg |
43171420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University