View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13812_low_12 (Length: 280)
Name: NF13812_low_12
Description: NF13812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13812_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 266
Target Start/End: Complemental strand, 30350385 - 30350131
Alignment:
| Q |
10 |
ataatactatactatccattcttttcaattttttatttacttgttt-ctttgtacgtagatcataaatttctgtctgttttgctagcaattgtttgatag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30350385 |
ataatactatactatccattcttttcaattttttatttacttgttttctttgta----gatcataaatttctgtctattttgctagcaattgtttgatag |
30350290 |
T |
 |
| Q |
109 |
aagttctagtatgaagatatgcctatggaaatttgcttatttgaacttatttatag-ttattagtactttttgagattatgttatggatcttttataaac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30350289 |
aagttctagtatgaagatatgcctatggaaatttgcttatttgaacttatttatagtttattagtactttttgagattatgttatggatcttttataaac |
30350190 |
T |
 |
| Q |
208 |
agatgactaatttgtcttgtcttgcacatacaaatcaaactatttttaaagtagtaatt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30350189 |
agatgactaatttgtcttgtcttgcacatacaaatcaaactaattttaaagtagtaatt |
30350131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University