View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13812_low_14 (Length: 265)
Name: NF13812_low_14
Description: NF13812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13812_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 172
Target Start/End: Original strand, 7994964 - 7995119
Alignment:
| Q |
18 |
ctagtgacatattatattcatgcaatgattttatatcattttctgnnnnnnnnnn-cgcttcaagcaattttgctaaactagattatgaatttcaaatat |
116 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7994964 |
ctagtgacaaattatatcattgcaatgattttatatcattttctgtttttttttttcgcttcaagcaattttgctaaactagattatgaatttcaaatat |
7995063 |
T |
 |
| Q |
117 |
tcaaagaatccaacgcatgccggtggcaattatggtgtgtcctatgtcgttttgca |
172 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
7995064 |
tcaaagaatccaaggcatgccggtggcaattatggtgtgtcctttgtcgatttgca |
7995119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 200 - 254
Target Start/End: Original strand, 7995116 - 7995170
Alignment:
| Q |
200 |
tgcaaccagcacaatgcacacaactagcaaaacgattagaaacttcatgcttctt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7995116 |
tgcaaccagcacaatgcacacaactagcaaaacgattagaaacttcatgcttctt |
7995170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University