View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13813_low_12 (Length: 237)
Name: NF13813_low_12
Description: NF13813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13813_low_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 14959544 - 14959306
Alignment:
| Q |
1 |
ctcttctctatatttgtcaacatgattttcatctcaaaaagttgtgtattaggtacttgacattgctggtggatgatttggaagcatattcacatttgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14959544 |
ctcttctctatatttgtcaacatgattttcatctcaaaaagttgtgtattaggtacttgacattgctggtggatgatttggaagcatattcacatttgcg |
14959445 |
T |
|
| Q |
101 |
tagctgcaatcaacgagtatagtgaaaatgttcctcctatagttgaacctttaatgtacaaaagt--tactactaacaaattgtagcaacaaaacttcaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| ||||||||||||||||||||||||||| |
|
|
| T |
14959444 |
tagctgcaatcaacgagtatagtgaaaatgttcctcctatagttgaacctttaatgtacgaagttagtactattaacaaattgtagcaacaaaacttcaa |
14959345 |
T |
|
| Q |
199 |
attaaaagacatgtcatgtatctgacacatgtttggtct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14959344 |
attaaaagacatgtcatgtatctgacacatgtttggtct |
14959306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University