View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13813_low_6 (Length: 318)
Name: NF13813_low_6
Description: NF13813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13813_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 100 - 286
Target Start/End: Complemental strand, 45367886 - 45367699
Alignment:
| Q |
100 |
tattggttaattagataaaaatgttaaggtagaaagaagagtgatattgatattgattgggtgggtcaattgatcatagagagtaaccacacaccaccac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367886 |
tattggttaattagataaaaatgttaaggtagaaagaagagtgatattgatattgattgggtgggtcaattgatcatagagagtaaccacacaccaccac |
45367787 |
T |
 |
| Q |
200 |
ccaaatcattgatagagactgttgttgccaacaaaaatataaacaccagtaggacc-cccctcccttaataactctgcttctctttct |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45367786 |
ccaaatcattgatagagactgttgttgccaacaaaaatataaacaccagtaggaccccccctcccttaataactctgcttctctttct |
45367699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 12 - 56
Target Start/End: Complemental strand, 45367974 - 45367930
Alignment:
| Q |
12 |
atgaatgagatccgttttcaccttttgaattgtgttcctagcaat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367974 |
atgaatgagatccgttttcaccttttgaattgtgttcctagcaat |
45367930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University