View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13813_low_8 (Length: 264)
Name: NF13813_low_8
Description: NF13813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13813_low_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 52630934 - 52631197
Alignment:
| Q |
1 |
tgcttaacctcccaaaatccaatgaagctgcttctaattcagcggcctccgtgcttacttcaccttcaagtcctatgtggaggatctccgttaatgtttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630934 |
tgcttaacctcccaaaatccaatgaagctgcttctaatttagcggcctccgtgcttacttcaccttcaagtcctatgtggaggatctccgttaatgtttg |
52631033 |
T |
|
| Q |
101 |
atccactgttaatccttcagatacaattatacggcatatggtgaatgtcaacagaatagtaacaacgttcttgatgttgttcttcacggttgccattgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52631034 |
atccactgttaatccttcagatacaattatacggcatatggtgaatgtcaacagaatagtaacaacgttcttgatgttgttcttcacggttgccattgat |
52631133 |
T |
|
| Q |
201 |
gattatttannnnnnncaaaccctatatatctatgatattgtatataacggaaaactaattata |
264 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52631134 |
gattatttatttttttcaaaccctatatatctatgatattgtatataacggaaaactaattata |
52631197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University