View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_high_37 (Length: 274)
Name: NF13814_high_37
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 3469382 - 3469132
Alignment:
| Q |
10 |
gaatatctaaaccagtttaggtttaatgtagatgaagtcgaatctgcaacacagtatttttcagaagtgaatttattgcgtaagagcaaattctcggcaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469382 |
gaatatctaaaccagtttaggtttaatgtagatgaagtcgaatctgcaacacagtatttttcagaagtgaatttattgcgtaagagcaaattctcggcaa |
3469283 |
T |
 |
| Q |
110 |
cgtataagggagttctcagagatggttctcttgtggctattacaagcattaacatgtcatgctgcaaaactgaggaagccgaatttgtaaagggattgag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469282 |
cgtataagggagttctcagagatggttctcttgtggctattacaagcattaacatgtcatgctgcaaaactgaggaagccgaatttgtaaagggattgag |
3469183 |
T |
 |
| Q |
210 |
cttattaacctcacttagacatgaaaacgttgtcaagctaagaggtttctg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469182 |
cttattaacctcacttagacatgaaaacgttgtcaagctaagaggtttctg |
3469132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University