View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_high_46 (Length: 245)
Name: NF13814_high_46
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_high_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 6 - 81
Target Start/End: Complemental strand, 26509006 - 26508931
Alignment:
| Q |
6 |
tagattattctgcgagaagtagcattattgtttttattttcttaacaagtgtctcagagactagtttagaataacc |
81 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
26509006 |
tagaatattctgcgagaagtagcattattgtttttatttttttaacaagtgtctcagagactaatttagaataacc |
26508931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 26508852 - 26508781
Alignment:
| Q |
160 |
gtatcttgtgatgga-ttagcttactcttatcttatatttgacaaaaattgcatgtgatcgttcatataatt |
230 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26508852 |
gtatcttgtgatggaattagcttactcttatcttatatttgaccaaaattgcatgtgatcgttcatataatt |
26508781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University