View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_high_48 (Length: 234)
Name: NF13814_high_48
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_high_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 218
Target Start/End: Complemental strand, 42348439 - 42348232
Alignment:
| Q |
11 |
gagatgaacatactcaagcttgccaatgggaaagactctgcggctacccttttgatcagaagaaacaccaatgaatgcaccattgatcaaagaaccacca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42348439 |
gagatgaacatactcaagcttgccaatgggaaagactctgcggctacccttttgatcagaagaaacaccaatgaatgcaccattgatcaaagaaccacca |
42348340 |
T |
|
| Q |
111 |
gaagcaggagtaacaagaacattctcatgaacctgactcagaaccttcttccctaacaccatcaagtttccatcaccaacagatattcctgcccctacag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42348339 |
gaagcaggagtaacaagaacattctcatgaacctgactcagaaccttcttccctaacaccatcaagtttccatcaccaacagatattcctgcccctacag |
42348240 |
T |
|
| Q |
211 |
tcatcttt |
218 |
Q |
| |
|
|||||||| |
|
|
| T |
42348239 |
tcatcttt |
42348232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University