View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_high_52 (Length: 217)
Name: NF13814_high_52
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_high_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 41552986 - 41552787
Alignment:
| Q |
1 |
atggcatacacattctttgcagtcatctacgtgatccaatgtatgatagagttactagctccatataa-ccaatattagattattcttttgggtacatat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41552986 |
atggcatacacattctttgcagtcatctacgtgatccaatgtatgatagagttactagctccatataaaccaatattagattattcttttgggtacatat |
41552887 |
T |
 |
| Q |
100 |
ttgaatatgcatataaactttatcctttttcaacacatgcaaccacgtgcccttccaattacataaccaaacattggccatggattggaggggataactt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41552886 |
ttgaatatgcatataaactttatcctttttcaacacatgcaaccacgtgcccttccaattacataaccaaacattggccatggattggaggggataactt |
41552787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University