View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_low_34 (Length: 311)
Name: NF13814_low_34
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 258
Target Start/End: Complemental strand, 8393194 - 8392953
Alignment:
| Q |
17 |
aatattatcacatgtcattgaattcatagcataccaaagaaaaatcactttgccttttaagctaatttaatgatgctttttgaattgtttgatgaaggtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393194 |
aatattatcacatgtcattgaattcatagcataccaaagaaaaatcactttgccttttaagctaatttaatgatgctttttgaattgtttgatgaaggtt |
8393095 |
T |
 |
| Q |
117 |
gttttgagttgttgggatggtatgaaacacaaggaccactcaaggcttcaacccccaatcattatctgcagagacaaattaatcaaaggttaaataaact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393094 |
gttttgagttgttgggatggtatgaaacacaaggaccactcaaggcttcaacccccaatcattatctgcagagacaaattaatcaaaggttaaataaact |
8392995 |
T |
 |
| Q |
217 |
cttgattcagaagaatactagataaatattttgtagacatgt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8392994 |
cttgattcagaagaatactagataaatattttgtagacatgt |
8392953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University