View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_low_40 (Length: 266)
Name: NF13814_low_40
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 42 - 249
Target Start/End: Complemental strand, 2699600 - 2699381
Alignment:
| Q |
42 |
aatgttccaatgagactagttagcaaggtttgaaccactcaattcagtttggagctcagcatgcccaacttattctaaatccaatgtatatacgtcaaat |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2699600 |
aatgttccaatgagactagttagcaaggttggaaccactcaattcagtttggagctcagcatgtccaacttattctaaatccaatgtatatatgtcaaat |
2699501 |
T |
 |
| Q |
142 |
atgcccctcacaacttacaattcttaactctttacgtctttgtcccttcctttttct------------cttcaccatttctaaaacgtgttattaagat |
229 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2699500 |
atggcccccacaacttacaattcttaactctttacgtctttgtcccttcctttttctcttcctttttctcttcaccatttctaaaacgtgttattaagat |
2699401 |
T |
 |
| Q |
230 |
ttttcaaatatttttaggaa |
249 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
2699400 |
tttttaaatatttttaggaa |
2699381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University