View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_low_41 (Length: 258)
Name: NF13814_low_41
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_low_41 |
 | |
|
| [»] scaffold0685 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 29559780 - 29559947
Alignment:
| Q |
1 |
caggatcagagacatatagaaatgcttcttttggatggatcaacgtgaaggatgcttcaaatgcccatattaatgcatatgaagatgcttcagcaagtga |
100 |
Q |
| |
|
|||| ||||| |||||||||| |||| |||| ||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29559780 |
caggttcagaaacatatagaactgctgctttcagatggatcaacgtgaaggatgttgcaaacgcccatattaatgcatatgaagatgcttcagcaagtgg |
29559879 |
T |
|
| Q |
101 |
aagatattgtttggccgaaagagtgatgcatttctctgaagttgtaaccattttgtgtcgtatgtatc |
168 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||| ||||||| || ||||||||| |
|
|
| T |
29559880 |
aagatattgcttggccgaaagagtgatgcatttctctgaacttgtaaacattttgcgttgtatgtatc |
29559947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 29549858 - 29549997
Alignment:
| Q |
1 |
caggatcagagacatatagaaatgcttcttttggatggatcaacgtgaaggatgcttcaaatgcccatattaatgcatatgaagatgcttcagcaagtga |
100 |
Q |
| |
|
|||| ||||| ||||||| |||||| ||||||||||||| || ||||||||| | ||||||| |||||| | |||||||| |||||||||| |||| |
|
|
| T |
29549858 |
caggttcagaaacatatatgaatgctgcttttggatggattaatgtgaaggatattgcaaatgcacatattcaagcatatgagaatgcttcagctagtgg |
29549957 |
T |
|
| Q |
101 |
aagatattgtttggccgaaagagtgatgcatttctctgaa |
140 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| |||||| |
|
|
| T |
29549958 |
aagatattgtttggtcgaaagagtgatacatttttctgaa |
29549997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 21 - 124
Target Start/End: Original strand, 29556451 - 29556554
Alignment:
| Q |
21 |
aatgcttcttttggatggatcaacgtgaaggatgcttcaaatgcccatattaatgcatatgaagatgcttcagcaagtgaaagatattgtttggccgaaa |
120 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| | | || || |||||| |||||||||| ||||||||| | |||| ||||||||||||||| |||| |
|
|
| T |
29556451 |
aatgctacttttggatggatcaatgtgaaggatgttgcgaacgctcatattcatgcatatgaggatgcttcaactagtggaagatattgtttggctgaaa |
29556550 |
T |
|
| Q |
121 |
gagt |
124 |
Q |
| |
|
|||| |
|
|
| T |
29556551 |
gagt |
29556554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 183 - 247
Target Start/End: Original strand, 29560407 - 29560472
Alignment:
| Q |
183 |
tttactgaatctttgtttaaacaatgggtaact-cagcattaatccaaattccaacatctcatatc |
247 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
29560407 |
tttactcaatctttgtttaaacaataggtaacttcagcattaatccagattccaacatctcatatc |
29560472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0685 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: scaffold0685
Description:
Target: scaffold0685; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 21 - 124
Target Start/End: Original strand, 5551 - 5654
Alignment:
| Q |
21 |
aatgcttcttttggatggatcaacgtgaaggatgcttcaaatgcccatattaatgcatatgaagatgcttcagcaagtgaaagatattgtttggccgaaa |
120 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| | | || || |||||| |||||||||| ||||||||| | |||| ||||||||||||||| |||| |
|
|
| T |
5551 |
aatgctacttttggatggatcaatgtgaaggatgttgcgaacgctcatattcatgcatatgaggatgcttcaactagtggaagatattgtttggctgaaa |
5650 |
T |
|
| Q |
121 |
gagt |
124 |
Q |
| |
|
|||| |
|
|
| T |
5651 |
gagt |
5654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University