View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_low_45 (Length: 249)
Name: NF13814_low_45
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_low_45 |
 | |
|
| [»] scaffold0542 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0542 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0542
Description:
Target: scaffold0542; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 7552 - 7341
Alignment:
| Q |
16 |
accaatgagattaagatatggcaatctccaattccatatctatttggtggcttagccataatgctaattttaatttcagttgcattggtgatccttgtat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7552 |
accaatgagattaagatatggcaatctccaattccatatctatttggaggcttagccataatgctaattttaatttcagttgcattggtgatccttgtat |
7453 |
T |
|
| Q |
116 |
gctcctacaaaaaacgtggttcttcttctcaatcatcatcaaattcagatgaagaaatgaaacaggtaatgtccaagaacatagagaagattaattctga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7452 |
gctcctacaaaaaacgtggttcttcttctcaatc---atcaaattcagatgaagaaatgaaacaggtaatgtccaagaacatagagaagattaattctga |
7356 |
T |
|
| Q |
216 |
cccagaagtacttgt |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7355 |
gccagaagtacttgt |
7341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University