View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13814_low_48 (Length: 245)

Name: NF13814_low_48
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13814_low_48
NF13814_low_48
[»] chr1 (2 HSPs)
chr1 (6-81)||(26508931-26509006)
chr1 (160-230)||(26508781-26508852)


Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 6 - 81
Target Start/End: Complemental strand, 26509006 - 26508931
Alignment:
6 tagattattctgcgagaagtagcattattgtttttattttcttaacaagtgtctcagagactagtttagaataacc 81  Q
    |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||    
26509006 tagaatattctgcgagaagtagcattattgtttttatttttttaacaagtgtctcagagactaatttagaataacc 26508931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 160 - 230
Target Start/End: Complemental strand, 26508852 - 26508781
Alignment:
160 gtatcttgtgatgga-ttagcttactcttatcttatatttgacaaaaattgcatgtgatcgttcatataatt 230  Q
    ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
26508852 gtatcttgtgatggaattagcttactcttatcttatatttgaccaaaattgcatgtgatcgttcatataatt 26508781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University