View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13814_low_52 (Length: 227)
Name: NF13814_low_52
Description: NF13814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13814_low_52 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 23889718 - 23889938
Alignment:
| Q |
7 |
ataatgcaaaagctttggattaaataaatatgttcataaaatttaatgctataatttgttgcattttcattacttgaaggacagtttttggaacaaatga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23889718 |
ataatgcaaaagctttggattaaataaatatgttaataaaatttaatgctataatttgttgcattttcattacttgaaggacagtttttggaacaaatga |
23889817 |
T |
 |
| Q |
107 |
gagaaatatattggtttatgggctaaagaattttgaacaagttgattatgggagtaaccacgatttgttgtaaaataattagtagtcactcaattatggt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23889818 |
gagaaatatattggtttatgggctaaagaattttgaacaagttgattatgggagtaaccacgatttgtggtaaaataattagtagtcactcaattatggt |
23889917 |
T |
 |
| Q |
207 |
aaattgatctttcacaagtct |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23889918 |
aaattgatctttcacaagtct |
23889938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University