View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13815_high_16 (Length: 251)
Name: NF13815_high_16
Description: NF13815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13815_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 233
Target Start/End: Complemental strand, 37406150 - 37405927
Alignment:
| Q |
10 |
attatactagtttcagtgcagttgctaaaacagcttgataattgtgtggatggtattgtgttcttttgaggcttgatctacctatcatggaagctttcag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37406150 |
attatactagtttcagtgcagttgctaaaacagcttgataattgtgtggatggtattgtgttcttttgaggcttgatctacctatcatggaagctttcag |
37406051 |
T |
|
| Q |
110 |
aaatcacttgagaaaagtgttgagaacatgaaggtatgttaatgctgattctcgcttttttaggctgtagttagatcgacaaatcagggacttatggttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37406050 |
aaatcacttgagaaaagtgttgagaacatgaaggtatgttaatgctgattctcgcttttttaggctgtagttagatcgacaaatcagggacttatggttc |
37405951 |
T |
|
| Q |
210 |
tatactgaattgaaaattaatttg |
233 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37405950 |
tatactgaattgaaaattaatttg |
37405927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 106 - 177
Target Start/End: Original strand, 11510540 - 11510611
Alignment:
| Q |
106 |
tcagaaatcacttgagaaaagtgttgagaacatgaaggtatgttaatgctgattctcgcttttttaggctgt |
177 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||| ||||||||||||| |||| |||||||||| |||| |
|
|
| T |
11510540 |
tcagaagtcacctgagaaaagtgttgagaacatgaaagtatgttaatgctagttcttgcttttttagtctgt |
11510611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University