View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13815_low_5 (Length: 400)
Name: NF13815_low_5
Description: NF13815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13815_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 143 - 374
Target Start/End: Original strand, 4143152 - 4143377
Alignment:
| Q |
143 |
atcaaattgtcatactaaagttatgtctactataatatgtttacacaaagtttaattgataattatactaaattaattaaagcaccttttatgaaattcc |
242 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||||||||| ||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4143152 |
atcaaattgtcataataaagttttctctactataatatggttacacaaagtttaattcataataatacta----aattaaagcaccttttatgaaattct |
4143247 |
T |
|
| Q |
243 |
atattggatttcgattttgtctccaattggggatatgtttgttaattggttcatcatgtgattcattgcaaacnnnnnnnggtacaaaagttaaagcact |
342 |
Q |
| |
|
|||| | ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4143248 |
atatagaatttcaattttgtctccaattgggg--atgtttgttaattggttcatcatgtgattcattgcaaacttttttaggtacaaaagttaaagcact |
4143345 |
T |
|
| Q |
343 |
atatcaaatcgtacgttttgaatagaggattc |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4143346 |
atatcaaatcgtacgttttgaatagaggattc |
4143377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 20 - 142
Target Start/End: Original strand, 4142923 - 4143045
Alignment:
| Q |
20 |
gcgaccacctcttgtcaagtttcttacgaaggtcatgtcaatgcaatactcatagcctgtcttgttcacttccaatacgttgtagtatcttttgttgaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||| || ||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
4142923 |
gcgaccacctcttgtcaagtttcttatgaaggtcatgtcgatgcagtaatcatagcctgtcttgttcacttccaatacattgtagtatcttttgtcaaag |
4143022 |
T |
|
| Q |
120 |
acaaattctacacaccaaaccaa |
142 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
4143023 |
acaaattctacacaccataccaa |
4143045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University