View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13816_high_9 (Length: 245)
Name: NF13816_high_9
Description: NF13816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13816_high_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 245
Target Start/End: Original strand, 44607595 - 44607824
Alignment:
| Q |
17 |
acaataagcaactaaataaacaggaaatatgtagaacatatgagaacatttgttagtatatgagggaaggtttcaccgagttgtattattacattga-ct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | || |
|
|
| T |
44607595 |
acaataagcaactaaataaacaggaaatatgtagaacatatgagaacatttgttagtatatgagggaaggtctcaccgagttgtattattacattaaact |
44607694 |
T |
 |
| Q |
116 |
taaatgcaatcacacaaaccaattctaaattttttagatagattagcctaacttttaccttctctctaaatttcttcttattattctttcattgaaaatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44607695 |
taaatgcaatcacacaaaccaattctaaattttttagatagattagcctaacttttaccttctctctaaatttcttcttattattctttcattgaaaatg |
44607794 |
T |
 |
| Q |
216 |
agtcgcatctttttattttatttatctttt |
245 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
44607795 |
agtcacatctttttattttatttatctttt |
44607824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University