View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13816_low_8 (Length: 316)
Name: NF13816_low_8
Description: NF13816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13816_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 6 - 180
Target Start/End: Complemental strand, 38186993 - 38186819
Alignment:
| Q |
6 |
tgaataaacacaattcattttgagccctaatcattgaattggtgtttgaatttcaaccttcatggccttgattctcataatcgcttctttcattttcctt |
105 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186993 |
tgaataaaaacaattcattttgagcactaatcattgaattggtgtttcaatttcaaccttcatggccttgattctcataatcgcttctttcattttcctt |
38186894 |
T |
 |
| Q |
106 |
tggattatttctctatgcaaaattttccttctcccccgtacccctttcaccaaacattttaccctcgatggtaag |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186893 |
tggattatttctctatgcaaaattttccttctcccccgtacccctttcaccaaacattttaccctcgatggtaag |
38186819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 265 - 306
Target Start/End: Complemental strand, 38186733 - 38186692
Alignment:
| Q |
265 |
ggaagagaaatgtcttgctggttattgctcaccctgatgatg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38186733 |
ggaagagaaatgtcttgctggttattgctcaccctgacgatg |
38186692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University