View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13817_high_17 (Length: 227)
Name: NF13817_high_17
Description: NF13817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13817_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 18458360 - 18458165
Alignment:
| Q |
16 |
caaagtcttgctagccgtcttaatttgtgaagagattgaatcttttagacttcgaaattgctttaagattgtcttcaaggcaagggatgtgtaagatttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
18458360 |
caaagtcttgctagccgtcttaatttgtgaagagattgaatcttttagacttcgaaattgctttgagattgtctttaaggcaagggatgtgtaagatttt |
18458261 |
T |
|
| Q |
116 |
gatgctccatatcctgttgcttgctcaaatgatgatatcacactttgcatttgatggtggtattgtctgtaccttagctctacctacattgttcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18458260 |
gatgctccatatcctgttgcttgctcaaatgatgatatcacactttgcatttgatggtggtattgtctgtaccttagctctacctacattgttcat |
18458165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University