View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13817_high_7 (Length: 370)
Name: NF13817_high_7
Description: NF13817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13817_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 355
Target Start/End: Original strand, 48965190 - 48965544
Alignment:
| Q |
1 |
tcatcaggatttgttacaaagacattgcaattcctgttgcctctactcatattggcctttgcgtttgctatgcagcactacggaaaaaagaaacaagtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965190 |
tcatcaggatttgttacaaagacattgcaattcctgttgcctctactcatattggcctttgcgtatgctatgcagcactacggaaaaaagaaacaagtca |
48965289 |
T |
 |
| Q |
101 |
gcgactcataaaacctgaacttggagcaacaattattttgtgcatgaatcaaatgcattactctgcccaatacaatgcagggctcttgatgtactatgat |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965290 |
gcgactcataaaacctgaacttgaagcaacaattattttgtgcatgaatcaaattcattactctgcccaatacaatgcagggctcttgatgtactatgat |
48965389 |
T |
 |
| Q |
201 |
gtcttgctaaacaaccatactagctgttcatttagactcaattgatttaacatctcatattttgaaatgaatgttataaagattattcattatcttacac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48965390 |
gtcttgctaaacaaccatactagctgttcatttagactcaattgatttaacatctcatattttgaaatgaatgttataaagattattcattatcttacac |
48965489 |
T |
 |
| Q |
301 |
atcgtgctaaacagaatgagtttgttgtctagggccttcttctgttaattgttat |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48965490 |
atcgtgctaaacagaatgagtttgttgtctagggccttcttctgttcattgttat |
48965544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University