View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13819_low_6 (Length: 218)
Name: NF13819_low_6
Description: NF13819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13819_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 15953610 - 15953421
Alignment:
| Q |
18 |
gtataatggtcgtttttgcaatgacaatgttacaataatatgaaacaataatactatatgttattattcnnnnnnncaaatactatatgttattgttcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15953610 |
gtataatggtcgtttttgcaatgacaatgttacaataatatgaaacaataatactatatgttattattcaaaaaaacaaatactatatgttattgttcat |
15953511 |
T |
 |
| Q |
118 |
attataattttataataaaactttagtttgataatccataatttaattatatgaaacttactatttaaatcaaacaatatagagtataat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15953510 |
attataattttataataaaactttagtttgataatccataatttaattatatgaaacttactatttaaatcaaacaatatagagtataat |
15953421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 54
Target Start/End: Original strand, 16399236 - 16399269
Alignment:
| Q |
21 |
taatggtcgtttttgcaatgacaatgttacaata |
54 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
16399236 |
taatgatcgtttttgcaatgacaatgttacaata |
16399269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University