View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381_high_15 (Length: 251)
Name: NF1381_high_15
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 26 - 163
Target Start/End: Original strand, 10055727 - 10055864
Alignment:
| Q |
26 |
ataaagctaactaagtaccccattcgtacatatcgtaaaccaaatttaacgagtgcaacgttggcacttcattnnnnnnnctgatccagggacaattgct |
125 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10055727 |
ataaagctaactaagtacc--attcgtacatatcgtaaaccaaatttaacgagtgcaacgttggcacttcattaaaaaaactgatccagggacaattgct |
10055824 |
T |
 |
| Q |
126 |
taacaaactaaca--ctcagtgtcaaattctacgtcattg |
163 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10055825 |
taacaaactaacactctcagtgtcaaattctacgtcattg |
10055864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 188 - 244
Target Start/End: Original strand, 10056869 - 10056925
Alignment:
| Q |
188 |
cattttaagatagcaatgaaacattaatgtttctttttcaatcttacatattattgg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10056869 |
cattttaagatagcaatgaaacattaatgtttctttttcaatcttacactttattgg |
10056925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University