View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381_high_7 (Length: 333)
Name: NF1381_high_7
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 115 - 322
Target Start/End: Original strand, 43543429 - 43543642
Alignment:
| Q |
115 |
catgtcgatgatattgagggcatggaattggtatcagaatagcctctccgttcatccggtgagaacccaagtcgccacctccggcgtcctttgggccgtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43543429 |
catgtcgatgatattgagggcatggaattggtatcagaatagcctctccgttcatccggtgagaacccaagtcgccacctccggcgtcctttgggccgtt |
43543528 |
T |
 |
| Q |
215 |
ggagatgtcactgctcagtacatcactcattcggcagctg------catcttctaaaaagcgtcttcagttatctgccactgtatgtcttttagcactac |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43543529 |
ggagatgtcactgctcagtacatcactcattcagcagctgcatcttcatcttctaaaaagcgtcttcagttatctgccactgtatgtcttttagcactac |
43543628 |
T |
 |
| Q |
309 |
ccatctctctctct |
322 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43543629 |
ccatctctctctct |
43543642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 43543370 - 43543410
Alignment:
| Q |
30 |
agacactggtctaatatccaacgagaaccaccgaattaatc |
70 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43543370 |
agacactggtctaatatccaacgagaagcaccgaattaatc |
43543410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University