View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1381_low_15 (Length: 298)
Name: NF1381_low_15
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1381_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 8 - 164
Target Start/End: Original strand, 10688823 - 10688978
Alignment:
| Q |
8 |
caaatatgcaaataatattggtatcgaacaagtttcacgcatattggtattggaggctagctcttacatttttgtagaaaaaacatcacctgtttttcat |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10688823 |
caaatatgcaaataatattgatatcgaacaagtttcacgcatattggtataggagactagctcttacatttttgaagaaaaaacatcacctgtttttcat |
10688922 |
T |
 |
| Q |
108 |
tttcttcaagagcattaatcaggaattaactgtttttcattagcatttgaataaatt |
164 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10688923 |
tttctt-aagagcattaatcaggcattaactgtttctcattagcatttgaataaatt |
10688978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University