View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1381_low_25 (Length: 251)

Name: NF1381_low_25
Description: NF1381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1381_low_25
NF1381_low_25
[»] chr8 (2 HSPs)
chr8 (26-163)||(10055727-10055864)
chr8 (188-244)||(10056869-10056925)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 26 - 163
Target Start/End: Original strand, 10055727 - 10055864
Alignment:
26 ataaagctaactaagtaccccattcgtacatatcgtaaaccaaatttaacgagtgcaacgttggcacttcattnnnnnnnctgatccagggacaattgct 125  Q
    |||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||    
10055727 ataaagctaactaagtacc--attcgtacatatcgtaaaccaaatttaacgagtgcaacgttggcacttcattaaaaaaactgatccagggacaattgct 10055824  T
126 taacaaactaaca--ctcagtgtcaaattctacgtcattg 163  Q
    |||||||||||||  |||||||||||||||||||||||||    
10055825 taacaaactaacactctcagtgtcaaattctacgtcattg 10055864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 188 - 244
Target Start/End: Original strand, 10056869 - 10056925
Alignment:
188 cattttaagatagcaatgaaacattaatgtttctttttcaatcttacatattattgg 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  |||||||    
10056869 cattttaagatagcaatgaaacattaatgtttctttttcaatcttacactttattgg 10056925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University