View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13820_high_20 (Length: 248)
Name: NF13820_high_20
Description: NF13820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13820_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 10047550 - 10047734
Alignment:
| Q |
16 |
gttgaaggaggaaaacgtgagtttgaattgaagggctgcaaataccaaaccaaatttaggctaaatagtataatactagagttgccaaatccgtttggta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10047550 |
gttgaaggaggaaaacgtgagtttgaattgaagggctgcaaataccaaaccaaatttaggctaaatagtataatactagagttgccaaatccgtttggta |
10047649 |
T |
 |
| Q |
116 |
cgcctttaaacaagaaaacaggtcagtttgatcaatagtaccctagttttcttggaccacatatatgatggtccaaccatgcataataaaaga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10047650 |
cgcctttaaacaagaaaacaggtcagtttgatcaa--------tagttttgttggaccacaaatatgatggtccaaccatgcataataaaaga |
10047734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University