View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13820_high_23 (Length: 213)
Name: NF13820_high_23
Description: NF13820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13820_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 33539264 - 33539385
Alignment:
| Q |
34 |
caaagtttatttgcctaaatccagaaactataaaatataagtctatgattatgtgtgagtcaatgctaactttgttatagcattgcactttgcattttta |
133 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33539264 |
caaagtttacttgcctaaatccagaaactataaaatataagtctatgattatgtgtgagtcaatgctaactttgttatagcattgcactttgcattttta |
33539363 |
T |
 |
| Q |
134 |
aat-tgtgcgcccaatactaac |
154 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
33539364 |
aatgtgtgcgcccaatactaac |
33539385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University