View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13820_low_19 (Length: 307)
Name: NF13820_low_19
Description: NF13820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13820_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 26 - 290
Target Start/End: Original strand, 41993078 - 41993345
Alignment:
| Q |
26 |
ttctttagcttcttcctttgattcatggtggggtgtaaatagctgacgacttggatattatgggagagtgtaacannnnnnnnn-cacgggtagctagcc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41993078 |
ttctttagcttcttcctttgattcatggtggggtgtaaatagctgacggcttggatattatgggagagtgtaacattttttttttcacgggtagctagcc |
41993177 |
T |
|
| Q |
125 |
tttatgtacatccgaatatcaatgaattatatcaatcaatgatt----aacgatatcaattttgtctcaaagtctattttgctcttgatattctctgctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41993178 |
tttatgtacatccgaatatcaatgaattatatcaatcaatgattaacgaacgatatcaattttgtctcaaagtccattttgctcttgatattctctgctt |
41993277 |
T |
|
| Q |
221 |
caatttctcctttcannnnnnnnnngctgaatattcttgaatcttgattaatgcttctgcatgttcagaa |
290 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41993278 |
caatttctcctttca--ttttttttgctgaatattcttgaatcttgattaatgcttctgcatgttcagaa |
41993345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University