View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13820_low_24 (Length: 240)
Name: NF13820_low_24
Description: NF13820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13820_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 5965031 - 5964817
Alignment:
| Q |
20 |
gtaggaaaagaaaatgcttaatgataattgttgagttgaataatcatatgcaaaagcacgaacatagaaccgtctataaaactacttaagagaatgataa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5965031 |
gtaggaaaagaaaatgcttaatgataattgttgagttgaataatcatatgcaaaagcatgaacagagaaccgtctataaaactacttaagagaatgataa |
5964932 |
T |
 |
| Q |
120 |
gtatcttagaattcttgaaataaaatatt----ggggggagccctcctcctggaagagaaaaagggctctgatagggttttgccttagggtttgctctct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5964931 |
gtatcttagaattcttgaaataaaatattgtggggggggggccctcctcctggaagagaaaaagggctctgatagggttttgccttagggtttgctctct |
5964832 |
T |
 |
| Q |
216 |
gccttctgtgctgct |
230 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
5964831 |
gccttctatgctgct |
5964817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 5969237 - 5969191
Alignment:
| Q |
22 |
aggaaaagaaaatgcttaatgataattgttgagttgaataatcatat |
68 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
5969237 |
aggaaaagaaaatgcttaatgataacttttgagttgattaatcatat |
5969191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 8714910 - 8714956
Alignment:
| Q |
22 |
aggaaaagaaaatgcttaatgataattgttgagttgaataatcatat |
68 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
8714910 |
aggaaaagaaaatgcttaatgataacttttgagttgattaatcatat |
8714956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University