View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13820_low_25 (Length: 238)
Name: NF13820_low_25
Description: NF13820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13820_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 51 - 221
Target Start/End: Original strand, 45047535 - 45047708
Alignment:
| Q |
51 |
atatatagattgcaaaattccatgcatcttgacaattttattttagagagtaaaataaaatgaaaacagacggattcattc----atttattagattata |
146 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45047535 |
atatataaattgcaaaattccatgcatcttgacaattttattttagagagtaaaataaaatgaaaacagacggattcattcaactatttattagattata |
45047634 |
T |
 |
| Q |
147 |
ttctcagattcagtaatcaccaacaaaaactctacaacttactcggtttttgtcctcagctttctttctcatatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45047635 |
ttctcagattcagtaatcaccaacaaaaactctacaacttactcggtttttgtcctcagc-ttctttctcatatt |
45047708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University