View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13820_low_26 (Length: 217)
Name: NF13820_low_26
Description: NF13820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13820_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 36135643 - 36135842
Alignment:
| Q |
1 |
acttgattattttgatgtatatattaacattaatatggcttatgaagaataagaaaattaaatttatgttattttgatcctattgttatgcatatatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36135643 |
acttgattattttgatgtatatattaacattaatatggcttatgaagaataagaaaattaaatttatgttattttgatcctattgttatgcatatatgat |
36135742 |
T |
 |
| Q |
101 |
tgagttgatcatatatcttgaataatatgttctcttcattatgaatgatagcctttactctcnnnnnnnatcctgaattcaaaatcgtgacagccggatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
36135743 |
tgagttgatcatatatcttgaataatatgttctcttcattatgaatgatagcctttactctctttttttatcctgaattcaaaatcgcgacagccggatg |
36135842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 41337075 - 41337161
Alignment:
| Q |
1 |
acttgattattttgatgtatatattaacattaatatggcttatgaagaataagaaaattaaatttatgttattttgatcctattgtt |
87 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
41337075 |
acttgattattttgatgtatatattaatattaatatggcttatgaaggataagaagataaaatttatgttattttgatcttattgtt |
41337161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 100 - 161
Target Start/End: Original strand, 41337294 - 41337355
Alignment:
| Q |
100 |
ttgagttgatcatatatcttgaataatatgttctcttcattatgaatgatagcctttactct |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41337294 |
ttgagttgatcatatatcttgaataatatgttctcttcattatgaatgatagcatttactct |
41337355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University