View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13820_low_27 (Length: 213)

Name: NF13820_low_27
Description: NF13820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13820_low_27
NF13820_low_27
[»] chr8 (1 HSPs)
chr8 (34-154)||(33539264-33539385)


Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 33539264 - 33539385
Alignment:
34 caaagtttatttgcctaaatccagaaactataaaatataagtctatgattatgtgtgagtcaatgctaactttgttatagcattgcactttgcattttta 133  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33539264 caaagtttacttgcctaaatccagaaactataaaatataagtctatgattatgtgtgagtcaatgctaactttgttatagcattgcactttgcattttta 33539363  T
134 aat-tgtgcgcccaatactaac 154  Q
    ||| ||||||||||||||||||    
33539364 aatgtgtgcgcccaatactaac 33539385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University