View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13822_high_19 (Length: 236)
Name: NF13822_high_19
Description: NF13822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13822_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 33588388 - 33588172
Alignment:
| Q |
5 |
tattacgataagtaacatttttaaaataacatgcatgggtaaatatgttatcaggaaacaatccagaacccatcggaggattaggagcacccactgaagt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33588388 |
tattacgataagtaacatttttaaaataacatgcatgggtaaatatattatcaggaaacaatccagaacccatcggaggattaggagcacccactgaagt |
33588289 |
T |
 |
| Q |
105 |
tgttgtcctacctccccaccctacttgatcggcatatggtaagttggagaataaagatgctggataatatccaatatgctcattttcattacttaaccac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33588288 |
tgttgtcctacctccccaccctacttgatcggcatatggtaagttggagaataaagatgctggataatatccaatatgctcattttcattacttagccac |
33588189 |
T |
 |
| Q |
205 |
caattttttgttgtagg |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33588188 |
caattttttgttgtagg |
33588172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University