View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13822_low_12 (Length: 322)
Name: NF13822_low_12
Description: NF13822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13822_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 10 - 307
Target Start/End: Original strand, 19641862 - 19642159
Alignment:
| Q |
10 |
gataattctaatggacgtaatatgttatcatctccagaaagttttgctattgaaggaaaacatgctgatattgctcttaagaatgcaggatcatctgaaa |
109 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19641862 |
gataattctaatcgacataatatgttatcatcttcagaaagttttgctattgaaggaaaacatgctgatattgctcttaagattgcaggatcatctgaaa |
19641961 |
T |
 |
| Q |
110 |
agaaactcgatatttcaaagatggccgtatcaaccgtcaacttatgcaagaggttacagttgcagccagcagtttggtgatgaaagaagcaatgtttgtt |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19641962 |
agaaacttgatatttcaaagatggccgtatcaaccgtcaacttatgcaagaggttacagttgcagccagcagtttggtgatgaaagaagcaatgtttgtt |
19642061 |
T |
 |
| Q |
210 |
agagaatcagctaccaagttggtattttggtgtgtaatcatgtaatatagtcttgcatattgtagaatatgctattaaatcctaatgtatatagtttt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19642062 |
agagaatcagctaccaagttggtattttggtgtgtaatcatgtaatatagtcttgtatattgtagaatatgctattaagtcctaatgtatatagtttt |
19642159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University