View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13822_low_19 (Length: 247)
Name: NF13822_low_19
Description: NF13822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13822_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 40 - 198
Target Start/End: Original strand, 31959021 - 31959179
Alignment:
| Q |
40 |
atgcaatgtatctatcaacttcgaactttctaaacactatcaaatccgaccgtttaaatcacacttgcctacagtgaaaaatactctattaccttctgac |
139 |
Q |
| |
|
||||||||||| |||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31959021 |
atgcaatgtatttatcaattccgaactttctaaacactatcaaatccaaccgtttaaatcacacttgcctacagtgaaaaatactctattaccttctgac |
31959120 |
T |
|
| Q |
140 |
ccatttagtggatcacgtattacgtacttatctcattctttctagcataattccgttat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31959121 |
ccatttagtggatcacgtattacgtacttatctcattctttctagtataattccgttat |
31959179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 240
Target Start/End: Original strand, 31959201 - 31959231
Alignment:
| Q |
210 |
gtaaaactttactttctgaggtgatccccta |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31959201 |
gtaaaactttactttctgaggtgatccccta |
31959231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University