View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_high_10 (Length: 405)
Name: NF13823_high_10
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 136 - 388
Target Start/End: Original strand, 12343406 - 12343658
Alignment:
| Q |
136 |
gtgcaagcccacataacaatacatagtttattattttcacacataaaccccaaaaacactaaaccaaaccctcgtccatttcctcatgctgccgttgttg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343406 |
gtgcaagcccacataacaatacatagtttattattttcacacataaaccccaaaaacactaaaccaaaccctcgtccatttcctcatgctgccgttgttg |
12343505 |
T |
 |
| Q |
236 |
ccgttgttgttgttgatgttttctttgcatcctgagcttttgactgtatatcttgtccaacttccttagtcttttgccccgcctcctttgtcttctgccc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343506 |
ccgttgttgttgttgatgttttctttgcatcctgagcttttgactgtatatcttgtccaacttccttagtcttttgccccgcctcctttgtcttctgccc |
12343605 |
T |
 |
| Q |
336 |
cacataacccaccacatctgccatcccccgcttcgccgactcgagttgctcag |
388 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
12343606 |
cacataacccaccacatctgccatcccctgcttggccgactcgagttgctcag |
12343658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 12343271 - 12343315
Alignment:
| Q |
1 |
cattacatattacacaacataaaacactagattacatattgaatt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343271 |
cattacatattacacaacataaaacactagattacatattgaatt |
12343315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University