View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_high_11 (Length: 402)
Name: NF13823_high_11
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 10 - 334
Target Start/End: Complemental strand, 26572297 - 26571973
Alignment:
| Q |
10 |
gatcataggctgtgttccaatcaacaacaagctcattttcaatattcacatgtcatttatttccttaaccaaacaaccttgttctcataatgtctctctt |
109 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26572297 |
gatcataggttgtgttccaatcaacaaccagctcattttcaatattcacatgtcatttctttccttaaccaaacaaccttgttctcataatgtctctctt |
26572198 |
T |
 |
| Q |
110 |
tttcttcttgaaaagaaatttagatgttatattcatttgaccatgcaacttaaacattattgtcattagctcttacatagcctcaggagttacaaggatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26572197 |
tttcttcttgaaaagaaatttagatgttatattcatttgaccatgcaactcaaacattattgtcattagctcttacatagcctcaggagttacaaggatt |
26572098 |
T |
 |
| Q |
210 |
gatgccatttctaactttaaggtttttatactgctttccttgaaatctcttttctttgtcacatcaatcttcaacatatatgtcttaaaggttggaaaca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26572097 |
gatgccatttctaactttaaggtttttatattgctttccttgaaatctcttttctttgtcacatcaatcttcaacatatatgtcttaaaggttggaaaca |
26571998 |
T |
 |
| Q |
310 |
tatcattgtcacatatatgtcccca |
334 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26571997 |
tatcattgtcacatatatgtcccca |
26571973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University