View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_high_24 (Length: 300)
Name: NF13823_high_24
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 87 - 132
Target Start/End: Original strand, 21284603 - 21284648
Alignment:
| Q |
87 |
aagttattgcatcatttccttcttcagcgtccatctctagtgtctc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21284603 |
aagttattgcatcatttccttcttcagcgtccatctctagtgtctc |
21284648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 285
Target Start/End: Original strand, 21284706 - 21284793
Alignment:
| Q |
190 |
tctttgttaatttatgaacatatatattattgatatgtgtagctttcaatattaaaatattaaattcctttaaaaagatatctgttaatttcaaac |
285 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| || |||||||||||| ||||||| |||||||||| |
|
|
| T |
21284706 |
tctttgttaatttatgaacatat-------tgatatgtgtagctttcaatatt-aaatattcaagtcctttaaaaaggtatctgtcaatttcaaac |
21284793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 67 - 129
Target Start/End: Original strand, 38007584 - 38007646
Alignment:
| Q |
67 |
ttccaactctctgttttccaaagttattgcatcatttccttcttcagcgtccatctctagtgt |
129 |
Q |
| |
|
||||||||| ||||| || || |||| | |||||||||||||||||| |||||||||||||| |
|
|
| T |
38007584 |
ttccaactcactgttatcaaagattatagtatcatttccttcttcagcctccatctctagtgt |
38007646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 120
Target Start/End: Original strand, 49282837 - 49282890
Alignment:
| Q |
67 |
ttccaactctctgttttccaaagttattgcatcatttccttcttcagcgtccat |
120 |
Q |
| |
|
||||||||| ||||| |||||| |||| | |||||||||||||||||| ||||| |
|
|
| T |
49282837 |
ttccaactcactgttatccaaaattatagtatcatttccttcttcagcctccat |
49282890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 245
Target Start/End: Original strand, 24168530 - 24168562
Alignment:
| Q |
213 |
atattattgatatgtgtagctttcaatattaaa |
245 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
24168530 |
atattattgatatgtgtagctttctatattaaa |
24168562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University