View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_high_25 (Length: 287)
Name: NF13823_high_25
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 57 - 162
Target Start/End: Original strand, 6890393 - 6890498
Alignment:
| Q |
57 |
aaaggtgttagttgcttgctatgttttcctatgtatgccctcttttaaatgttgaatgatattttttgttctatttactacgttcctcgtctctaattat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||| |||||||||| |
|
|
| T |
6890393 |
aaaggtgttagttgcttgctatgttttcatatgtatgccctcttttaaatgttgaatgatattctttgttctatttactacgctcttcgcctctaattat |
6890492 |
T |
 |
| Q |
157 |
aagatc |
162 |
Q |
| |
|
|||||| |
|
|
| T |
6890493 |
aagatc |
6890498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 6890311 - 6890367
Alignment:
| Q |
13 |
aatattaagcggtaagcagagctcggttttgtccacgataagccaaaggtgttagtt |
69 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
6890311 |
aatattaagcggtaatcagagctcggttttgtccacaacaggccaaaggtgttagtt |
6890367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 271
Target Start/End: Original strand, 6890551 - 6890598
Alignment:
| Q |
224 |
accatacttcttattaatattgttgattgccttaaaatatgaaaaatc |
271 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6890551 |
accatattccttattaatattgttgattgccttaaaatatgaaaaatc |
6890598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University