View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_high_26 (Length: 275)
Name: NF13823_high_26
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_high_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 21 - 263
Target Start/End: Complemental strand, 41077371 - 41077129
Alignment:
| Q |
21 |
ggagtagggaggaggaggaggtgttccgttacctttggaagagctcggcaccatcaaaggtattagctttttcttggactttgcttcttgaccgtattcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41077371 |
ggagtagggaggaggaggaggtgttccgttacctttggaagagctcggcaccatcaaaggtattagttttttcttggactttgcttcttgaccgtattcc |
41077272 |
T |
|
| Q |
121 |
gacaaaagctaatcttgataagaggcggatgttggatgaggatgtctcaaggtgttgttgtttttgcgataatgagggtgaaacatcaatccatctcttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077271 |
gacaaaagctaatcttgataagaggcggatgttggatgaggatgtctcaaggtgttgttgtttttgcgataatgagggtgaaacatcaatccatctcttt |
41077172 |
T |
|
| Q |
221 |
ttgcattgtgatgtggtttgtaaggtgtggttaagggtgatga |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077171 |
ttgcattgtgatgtggtttgtaaggtgtggttaagggtgatga |
41077129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University