View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13823_high_34 (Length: 227)

Name: NF13823_high_34
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13823_high_34
NF13823_high_34
[»] chr4 (1 HSPs)
chr4 (7-227)||(56043121-56043341)


Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 56043341 - 56043121
Alignment:
7 aatagcagagatagttagtggttgagttctgaaagtgaagaaagtgttgagaaagatgagtatgatgcaagaagtaattccaaggaaccatgaacggaaa 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56043341 aatagcagagatagttagtggttgagttctgaaagtgaagaaagtgttgagaaagatgagtatgatgcaagaagtaattccaaggaaccatgaacggaaa 56043242  T
107 gtcatgactggaagagaagggtcgtcggtttcagggacgacgagagctacttcttcaattggacatctgtcgtctgggggaacaccgtttgacgcttttt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56043241 gtcatgactggaagagaagggtcgtcggtttcagggacgacgagagctacttcttcaattggacatctgtcgtctgggggaacaccgtttgacgcttttt 56043142  T
207 cagtgtctggagttggattca 227  Q
    |||||||||||||||||||||    
56043141 cagtgtctggagttggattca 56043121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University