View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_high_35 (Length: 225)
Name: NF13823_high_35
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_high_35 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 16 - 225
Target Start/End: Complemental strand, 2817918 - 2817697
Alignment:
| Q |
16 |
gtttgaccaacttgtaaaaactatta-tgttctgacaagtta----gtaacggttccctttatttatgcaacgagtttgattgcatctcctttcacttcg |
110 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2817918 |
gtttgaccaacttgtaaaaactattaatgttctgataagttatttagtaacggttccctttatttatgcaacgagtttgattgcatctcctttcacttcg |
2817819 |
T |
 |
| Q |
111 |
gtatagtcggataacaacctccatagtactgact--------tctgaggtctgaaaagatagaaggaatatctaacctaannnnnnnatccattaccatc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2817818 |
gtatagtcggataacaacctccatagtactgactttccctactctgaggtctgaaaagatagaaggaatatctaacctaa-tttttgatccattaccatc |
2817720 |
T |
 |
| Q |
203 |
aacacagaatcatcccacaagtc |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2817719 |
aacacagaatcatcccacaagtc |
2817697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University