View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13823_high_36 (Length: 219)
Name: NF13823_high_36
Description: NF13823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13823_high_36 |
 | |
|
| [»] scaffold0002 (3 HSPs) |
| | |
|
| [»] scaffold0263 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 176; Significance: 6e-95; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 401682 - 401869
Alignment:
| Q |
15 |
aatatcagctgggaaattatttaaagaatctgggtaggacttgacgccaatgtattctctaaaaatgactggattcacatcattgtcaccgatgatagga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401682 |
aatatcagctgggaaattatttaaagaatctgggtaggacttcacgccaatgtattctctaaaaatgactggattcacatcattgtcaccgatgatagga |
401781 |
T |
|
| Q |
115 |
gctgttgacattttggaggatcgatatataagaaattaatatatactttgttttttgtgttttctatatgttggggtttagatagatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
401782 |
gctgttgacattttggaggatcgatatatgagaaattaatatatactttgttttttgtgttttctttatgttggggtttagatagatt |
401869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 108 - 202
Target Start/End: Original strand, 405323 - 405418
Alignment:
| Q |
108 |
gataggagctgttgacattttggaggatcgatatataagaaattaatatatacttt-gttttttgtgttttctatatgttggggtttagatagatt |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
405323 |
gataggagctgttgacatttcggaggatcgatatatgagaaattaatatataatttctttttttgtgttttccatatgttggggtttagatagatt |
405418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 24 - 110
Target Start/End: Original strand, 93525 - 93611
Alignment:
| Q |
24 |
tgggaaattatttaaagaatctgggtaggacttgacgccaatgtattctctaaaaatgactggattcacatcattgtcaccgatgat |
110 |
Q |
| |
|
|||||||||||| | |||| ||||||| | ||| |||||||||||||||| |||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
93525 |
tgggaaattattaagagaagctgggtatggcttcacgccaatgtattctcgaaaaatgaatggatcaacagcattgtcaccgatgat |
93611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0263 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0263
Description:
Target: scaffold0263; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 24 - 110
Target Start/End: Original strand, 15355 - 15441
Alignment:
| Q |
24 |
tgggaaattatttaaagaatctgggtaggacttgacgccaatgtattctctaaaaatgactggattcacatcattgtcaccgatgat |
110 |
Q |
| |
|
|||||||||||| | |||| ||||||| | ||| |||||||||||||||| |||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
15355 |
tgggaaattattaagagaagctgggtatggcttcacgccaatgtattctcgaaaaatgaatggatcaacagcattgtcaccgatgat |
15441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University